View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5885_low_28 (Length: 251)
Name: NF5885_low_28
Description: NF5885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5885_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 40522466 - 40522228
Alignment:
| Q |
1 |
ctcccaagtcaagtttcataagcctgatgattcaacatcactcatttgctcaatttgtttgggagattataaagattcagagtggttgcgtttcttacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40522466 |
ctcccaagtcaagtttcataagcctgatgattcaacatcactcatttgctcaatttgtttgggagattataaagatttagagtggttgcgtttcttacct |
40522367 |
T |
 |
| Q |
101 |
gattgtggtcacttttttcataaggactgtattgctgcatggtttaggttaaacctctcttgtcccctctgtcgaaacttgccaatcccaactcctcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40522366 |
gattgtggtcacttttttcataaggactgtattgctgcatggtttaggtcaaacctctcttgtcccctctgtcgaaacttgccaatcccaactcctcttt |
40522267 |
T |
 |
| Q |
201 |
ctgaagttacactcttggcaactacacataattgagtat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40522266 |
ctgaagttacactcttggcaactacacataattgagtat |
40522228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 28 - 192
Target Start/End: Complemental strand, 40526348 - 40526184
Alignment:
| Q |
28 |
tgattcaacatcactcatttgctcaatttgtttgggagattataaagattcagagtggttgcgtttcttacctgattgtggtcacttttttcataaggac |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40526348 |
tgattcaacatcactcatttgctcaatttgtttgggagattataaagattcagagtggttgcgtttcttacctgattgtggtcacttttttcataaggac |
40526249 |
T |
 |
| Q |
128 |
tgtattgctgcatggtttaggttaaacctctcttgtcccctctgtcgaaacttgccaatcccaac |
192 |
Q |
| |
|
||||||||| ||||||| ||| |||||||||| ||||| || |||||||||| |||| ||||||| |
|
|
| T |
40526248 |
tgtattgctacatggttcaggctaaacctctcatgtcctctatgtcgaaactcgccactcccaac |
40526184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University