View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5885_low_31 (Length: 237)
Name: NF5885_low_31
Description: NF5885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5885_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 63 - 218
Target Start/End: Complemental strand, 42293126 - 42292959
Alignment:
| Q |
63 |
ttcagaaaacaggtttctgcagttttaaccaggttttttgatttcccaaccttacatctaaaattctactccagaaatatacggcctttcannnnnnnag |
162 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42293126 |
ttcagaaaacaggtttctgcagttttagccaggttttttgatttcccaaccttacatctaaaattctactccagaaatatacggcctttcatttttttag |
42293027 |
T |
 |
| Q |
163 |
atctaaataaaat------------gaattgatgaggtttggtatcatgatctttgctttgcacttaa |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293026 |
atctaaataaaatgaattggaagaagaattgatgaggtttggtatcatgatctttgctttgcacttaa |
42292959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University