View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5886-Insertion-5 (Length: 310)
Name: NF5886-Insertion-5
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5886-Insertion-5 |
 | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 299
Target Start/End: Complemental strand, 30716 - 30427
Alignment:
| Q |
9 |
aatgcaacagaatgagtacctccacaggacacctgaccacaaaccaataaatagatatttcagcataaactagtcataactattattagtagaaaaacac |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
30716 |
aatgcaacagaatgagtacctccacaagacacctgaccacaaaccaataaatagatatttcagcat-aactagtcataactattattagtaaaaaaacac |
30618 |
T |
|
| Q |
109 |
taatgactattttacagccgaccctgagagaactttgtcgttaaactcttatcac--taagctaacacctttatggcgttatgtaattcaatggaagcta |
206 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || | | |||| || |||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
30617 |
taatgactattttacaatcgaccctgagagaactttatctcttga-ggttatgacgttaagctaacacc-ttatggcattatgtaattcaatggaagcta |
30520 |
T |
|
| Q |
207 |
attagagatgataagataagaaaaaattacataattagaaagcgctatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttc |
299 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
30519 |
attagagatgataagataagaaaaaagtacataattagaaagcgctatttgtgaaggtgaaatcatttccactatgaaagtgactgttgtttc |
30427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 252 - 310
Target Start/End: Complemental strand, 65704 - 65646
Alignment:
| Q |
252 |
tatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttcataaccatgat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65704 |
tatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttcataaccatgat |
65646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University