View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5886_low_10 (Length: 347)
Name: NF5886_low_10
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5886_low_10 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 29 - 319
Target Start/End: Complemental strand, 30716 - 30427
Alignment:
| Q |
29 |
aatgcaacagaatgagtacctccacaggacacctgaccacaaaccaataaatagatatttcagcataaactagtcataactattattagtagaaaaacac |
128 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
30716 |
aatgcaacagaatgagtacctccacaagacacctgaccacaaaccaataaatagatatttcagcat-aactagtcataactattattagtaaaaaaacac |
30618 |
T |
 |
| Q |
129 |
taatgactattttacagccgaccctgagagaactttgtcgttaaactcttatcac--taagctaacacctttatggcgttatgtaattcaatggaagcta |
226 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || | | |||| || |||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
30617 |
taatgactattttacaatcgaccctgagagaactttatctcttga-ggttatgacgttaagctaacacc-ttatggcattatgtaattcaatggaagcta |
30520 |
T |
 |
| Q |
227 |
attagagatgataagataagaaaaaattacataattagaaagcgctatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttc |
319 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
30519 |
attagagatgataagataagaaaaaagtacataattagaaagcgctatttgtgaaggtgaaatcatttccactatgaaagtgactgttgtttc |
30427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 272 - 341
Target Start/End: Complemental strand, 65704 - 65635
Alignment:
| Q |
272 |
tatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttcataaccatgatacctatgctac |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65704 |
tatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttcataaccatgatacctatgctac |
65635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University