View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5886_low_4 (Length: 547)
Name: NF5886_low_4
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5886_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 8 - 352
Target Start/End: Complemental strand, 38039649 - 38039305
Alignment:
| Q |
8 |
catcatcattaaattcctcctctacaagactacaacattcacctaacctctttctttctcatatcttctaacttcatttttcaccccttaacgctcgctt |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
38039649 |
catcatcattagattcctcctctacaagactacaacattcacctaacctctttctttctcatatcttctaacttcatttttcacaccttaatgctcgctt |
38039550 |
T |
 |
| Q |
108 |
caaaatcatccactttatttcccggcaaccaccgcgccggaaatcaccctcctccaccgtggtaagatttcctctcttttttcccttactcttgtcgtga |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039549 |
caaaatcatccactttatttcccggcgaccaccgcgccggaaatcaccctcctccaccgtggtaagatttcctctcttttttcccttactcttgtcgtga |
38039450 |
T |
 |
| Q |
208 |
tacttcatgcatgtgctgtactgtactgaaattcatgtattttcttctctgtttgttccaacaccgtaacaggacaacaccaccgtcaccggagcttcac |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039449 |
tacttcatgcatgtgctgtactgtactgaaattcatgtattttcttctctgtttgttccaacaccgtaacaggacaacaccaccgtcaccggagcttcac |
38039350 |
T |
 |
| Q |
308 |
accggaacattacttccgttatggtgtcctttccttcaaaggtta |
352 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
38039349 |
accggaacattactgccgtcatggtgtcctttccttcaaaggtta |
38039305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 449 - 532
Target Start/End: Complemental strand, 38039207 - 38039124
Alignment:
| Q |
449 |
caggtcgatgcagcttcacttcattgatttttgttcgtttgttttttatttgatccaccgtaatttccttgattatgagtgttt |
532 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38039207 |
caggtcgatgcagcttcacttcattgatttttgttcgtttgttttttatttgatccaccgtaatttccttgattatgagtgttt |
38039124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University