View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5886_low_9 (Length: 366)
Name: NF5886_low_9
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5886_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 18 - 356
Target Start/End: Complemental strand, 32645217 - 32644882
Alignment:
| Q |
18 |
attggcaaccttgatatgtttcgtgggaggagcacaagcaactgcggtggcacttgtggccgaacgtcattcacatgcttgggccattggctgggattat |
117 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32645217 |
attggcaaccttgatatgtctcgcgggaggagcacaagcaactgcggtggcacttgtggccgaacgtcattcacatgcttgggccattggctgggattat |
32645118 |
T |
|
| Q |
118 |
aggctctatgctcctctttacacggtttgttaatccgttaattagtttctcattcacaagcttagttagnnnnnnnttcaaataattttcttaatcagtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32645117 |
aggctctatgctcctctttacacggtttgttaatccgttaattagtttctcattcacaagcttagttagaaaaaaattcaaataattttcttaatcagtt |
32645018 |
T |
|
| Q |
218 |
tcttaatttattatatagggaatagttagttcaggaattgcatactatgttcaagggctggtgatgcaaatgagaggcccagtttttgcaacagctttta |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32645017 |
tcttaat---ttatatagggaatagttagttcaggaattgcatactatgttcaagggctggtgatgcaaatgagaggcccagtttttgcaacagctttta |
32644921 |
T |
|
| Q |
318 |
atcctctttgcatgatcatcgttgcttgtctgtgctcct |
356 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
32644920 |
atcctctttgcatgatcatcgttgcttgtttgggctcct |
32644882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University