View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887-Insertion-13 (Length: 182)
Name: NF5887-Insertion-13
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887-Insertion-13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 101 - 180
Target Start/End: Complemental strand, 39373950 - 39373871
Alignment:
| Q |
101 |
tttagcgtaatagagatataagcaacctgaattcacttttgtaacttgacaccataaattaagaataattaattccgagt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39373950 |
tttagcgtaatagaaatataagcaacttgaattcacttttgtaatttgacaccataaattaagaataattaattccgagt |
39373871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University