View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887-Insertion-14 (Length: 165)
Name: NF5887-Insertion-14
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887-Insertion-14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 9 - 165
Target Start/End: Original strand, 40512096 - 40512252
Alignment:
| Q |
9 |
accagatcttatgaatgaattgttgctcttattcattcaataatcgtctcggttgaggaattgaatttaacttgnnnnnnncctcactcaaaatgctttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
40512096 |
accagatcttatgaatgaattgttgctcttattcattcaataatcgtctcggttgaggaattgagtttaacttgtttttttcctcactcaaaatgatttg |
40512195 |
T |
 |
| Q |
109 |
ttttgttgcaacctaaataacaatgtaatccaatttgttaaggtttgtacgcagctc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40512196 |
ttttgttgcaacctaaataacaatgtaatccaatttgttaaggttggtacgcagctc |
40512252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University