View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887-Insertion-15 (Length: 115)
Name: NF5887-Insertion-15
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887-Insertion-15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 13713660 - 13713553
Alignment:
| Q |
8 |
atataattaccaggtggatcatagttacaactaataatggtgctacggccgtcattacactttaccttagcacatccaacccgaaccgaatcgcgccaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13713660 |
atataattaccaggtggatcatagttacaactaataatggtgctacgaccatcattacacttaaccttagcacatccaacccgaaccgaatcgcgccaga |
13713561 |
T |
|
| Q |
108 |
caacttga |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
13713560 |
caacttga |
13713553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University