View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887_high_15 (Length: 316)
Name: NF5887_high_15
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 16 - 126
Target Start/End: Original strand, 11614027 - 11614137
Alignment:
| Q |
16 |
atggtggattgtttttaaaactgggaaataacatgcttatcattattcaaaaaccatgacaggagttaggattatcaaagaggaagaaaaatgcgaaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11614027 |
atggtggattgtttttaaaactgggaaataacatgcttatcattattcaaaaaccatgaaaggagttaggattatcaaagaggaagaaaaatgcgaaata |
11614126 |
T |
 |
| Q |
116 |
acgttcataac |
126 |
Q |
| |
|
||||||||||| |
|
|
| T |
11614127 |
acgttcataac |
11614137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 218 - 299
Target Start/End: Original strand, 11614150 - 11614231
Alignment:
| Q |
218 |
agaggccaaaacttaagatttaagagtaaatttttccttttaaggtttactcacaatttcaaatttgaatgtcgtctcaact |
299 |
Q |
| |
|
|||||||||||||||| ||||| | ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11614150 |
agaggccaaaacttaaaatttacgtgtatatttttccttttaaggtttactcacaatttcgaatttgaatgtcgtctcaact |
11614231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University