View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887_high_19 (Length: 283)
Name: NF5887_high_19
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 118 - 277
Target Start/End: Complemental strand, 45814980 - 45814821
Alignment:
| Q |
118 |
gaatgttgatgttgtagactagtagttcccccttttcattgatctgattaactagtgtttcgtaaatggttttaatagtgtgtctcggtactttaattta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45814980 |
gaatgttgatgttgtagactagtagttcccccttttcattgatctgattaactagtgttttgtaaatggttttaatagtgtgtctcagtactttaattta |
45814881 |
T |
 |
| Q |
218 |
ggaaaagaaaggccatagaaccactgtgtcatgtttaaatataaaaagggagtaaggagg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45814880 |
ggaaaagaaaggccatagaaccactgtgtcatgtttaaatataaaaagggagtaaggagg |
45814821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 2 - 63
Target Start/End: Complemental strand, 45815096 - 45815035
Alignment:
| Q |
2 |
atgaaaatatgaaattcattttaactttcgtcactaaattagtgatgagggaattaggaaca |
63 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45815096 |
atgataatatgaaattcattttaactttcgtcactaaattagtgatgagggaattaggaaca |
45815035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University