View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887_high_28 (Length: 243)
Name: NF5887_high_28
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 6 - 226
Target Start/End: Original strand, 45666620 - 45666842
Alignment:
| Q |
6 |
aggagcagagagttggcttgttaatttagaggtatttctacaccaaataatagtattaaggttgacgagtctttcttttcttttcgt---acttcaatag |
102 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
45666620 |
aggagcagacagttggcttgttaatttagaggtatttctacaccaaataatagtattaaggttgacgagtctttcttttcttttcgtcgtactttaatag |
45666719 |
T |
|
| Q |
103 |
cannnnnnngtgaatttgttggctgattcccattttttgcaacatacatatatgccatggcatatataattaactgaaaatatttagaaataattaaagt |
202 |
Q |
| |
|
|| |||||||| ||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666720 |
catttttttgtgaattttttggctgattcccattttt-gtaacatgcatatatgccatggcatatataattaactgaaaatatttagaaataattaaagt |
45666818 |
T |
|
| Q |
203 |
tttaggatttctaactgtcatcat |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45666819 |
tttaggatttctaactgtcatcat |
45666842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University