View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887_high_8 (Length: 379)
Name: NF5887_high_8
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 13212515 - 13212421
Alignment:
| Q |
19 |
ttgttagcttccggtccggttgttatcatggcagcttcctttggaaatgctgcttatgaaaggctacctttagaagatgaagaaacaccagtgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212515 |
ttgttagcttccggtccggttgttatcatggcagcttcctttggaaatgctgcttatgaaaggctacctttagaagatgaagaaacaccagtgaa |
13212421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 119 - 230
Target Start/End: Original strand, 10000291 - 10000401
Alignment:
| Q |
119 |
agaacctgtgaaacttctgagtcatggtttaattggttaaaatatgcaacaaatataccggttcaaccaaccctggttgaaatggttcagccccgattca |
218 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||| | |||| ||||||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
10000291 |
agaaccggtgaaacttctgagtcatgatttaattggttaaaatatgcagcgaatacaccggttcaaccaactc-ggttgaaatggttcagtcccgattca |
10000389 |
T |
 |
| Q |
219 |
atccggttcaac |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10000390 |
atccggttcaac |
10000401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 287 - 363
Target Start/End: Original strand, 10001059 - 10001135
Alignment:
| Q |
287 |
acctccttcttatacttctccatattattgcatgcctttagtagtttctgaattatctctagctgtcattttataat |
363 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10001059 |
acctccttcttatacttctccatattgttgcatgccttcagtagtttctgaattatctctagctgtcattttataat |
10001135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University