View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887_low_21 (Length: 273)
Name: NF5887_low_21
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887_low_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 12 - 273
Target Start/End: Original strand, 40017700 - 40017961
Alignment:
| Q |
12 |
atcatcagtagaatgcccggccggacctatcccaccctagccatgcagaaccaatcaagcaccaaacaaacagatatgttaagtcataacaccgtatcaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40017700 |
atcatcagtagaatgcccggccggacctatcccaccctagccatgcagaaccaataaagcaccaaacaaacagatatgttaagtcataacaccgtatcaa |
40017799 |
T |
 |
| Q |
112 |
tacaaaccaaccaagtaaaagagaaagtatcatcaaaatttaatcacataatcacctgaaaaacaaccattgtgccaacggtggctgcggcatgagcagc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40017800 |
tacaaaccaaccaagtaaaagagaaagtatcatcaaaatttaatcacataatcacctgaaaaacaaccattgtgccaacggtggctgcggcatgagcagc |
40017899 |
T |
 |
| Q |
212 |
tcgaggagagggcgggtctccggccggtttaatcctaaacatcatcataacataaaacaaac |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40017900 |
tcgaggagagggcgggtctccggccggtttaatcctaaacatcatcataacataaaacaaac |
40017961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University