View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887_low_27 (Length: 247)
Name: NF5887_low_27
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 33412934 - 33413148
Alignment:
| Q |
17 |
catttacataccaaatactggttgcttcttgacagcttccaagtgggcagtatggtgttttagtcaacaatggaggtttggaattcactgggttgcttct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
33412934 |
catttacataccaaatactggttgcttcttgacagcttccaagtgggtagtatggtgttttagtccacaatggaggtttggaattcactgg-ttgcttct |
33413032 |
T |
 |
| Q |
117 |
tgacagctttccagtgggccatgtagtcttttttatatctattgttttatatcaatacataaataaaataatagagtataacttttcccaccctatcaga |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
33413033 |
tgacagctttccagtgggccatatagtcttttttatatctattgttttatatcaatacataaataaaataatagagtattacttttcccaccctttcaga |
33413132 |
T |
 |
| Q |
217 |
ttctcgccgctctgtg |
232 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
33413133 |
ttctcgccgccctgtg |
33413148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 138
Target Start/End: Complemental strand, 33641524 - 33641467
Alignment:
| Q |
80 |
tcaacaatggaggtttggaattcactgggttgcttcttgacagctttccagtgggccat |
138 |
Q |
| |
|
|||| ||||||| |||||||||||| ||||| |||||||||||||| || ||||||||| |
|
|
| T |
33641524 |
tcaataatggagttttggaattcac-gggttccttcttgacagcttccccgtgggccat |
33641467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University