View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5887_low_32 (Length: 238)
Name: NF5887_low_32
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5887_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 44737792 - 44737571
Alignment:
| Q |
1 |
gactgacaagtaaccgggtacaggcagttgtcgtatgggaatgagggctgaaggccgcacagcagcgcaccatgacatgttgtagttgtaaaggtgaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44737792 |
gactgacaagtaaccgggtacaggcagttgtcgtgtgggaatgagggctgaaggccgcacagcagcgcaccatgacatgttgtagttgtaaaggtgagac |
44737693 |
T |
|
| Q |
101 |
gcacgccatgcgaataagggacggttgaagagaaagaagctcagctccaacacacgtttttgtctgctagataccccacattcacctcgattactcccct |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44737692 |
gcacgccatgcgaataagagacggttgaagagaaagaagctcagctccaacacacgtttttgtctgctagataccccacattcacctcgattactcccct |
44737593 |
T |
|
| Q |
201 |
cttcatatgcacgctttcattt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44737592 |
cttcatatgcacgctttcattt |
44737571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University