View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5888-Insertion-3 (Length: 279)
Name: NF5888-Insertion-3
Description: NF5888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5888-Insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 142 - 253
Target Start/End: Complemental strand, 10000401 - 10000291
Alignment:
| Q |
142 |
gttgaaccggattgaatcggggctgaaccatttcaaccagggttggttgaaccggtatatttgttgcatattttaaccaattaaaccatgactcagaagt |
241 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| | ||||||||||||||| |||| | ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10000401 |
gttgaaccggattgaatcgggactgaaccatttcaacc-gagttggttgaaccggtgtattcgctgcatattttaaccaattaaatcatgactcagaagt |
10000303 |
T |
|
| Q |
242 |
ttcacaggttct |
253 |
Q |
| |
|
||||| |||||| |
|
|
| T |
10000302 |
ttcaccggttct |
10000291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 9 - 85
Target Start/End: Complemental strand, 10001135 - 10001059
Alignment:
| Q |
9 |
attataaaatgacagctagagataattcagaaactactaaaggcatgcaataatatggagaagtataagaaggaggt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10001135 |
attataaaatgacagctagagataattcagaaactactgaaggcatgcaacaatatggagaagtataagaaggaggt |
10001059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University