View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5888_low_2 (Length: 321)
Name: NF5888_low_2
Description: NF5888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5888_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 238
Target Start/End: Original strand, 46617842 - 46618065
Alignment:
| Q |
15 |
actttctagtaacttcctacctaatcctgcatctttcttttggaattcttttccttcttttttgggattgtgttcacttgacctgtcataagaaaacgag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46617842 |
actttctagtaacttcctacctaatcctgcatctttcttttggaattcttttccttcttttttgggattgtgttcacttgacctgtcataagaaaacgag |
46617941 |
T |
 |
| Q |
115 |
caaattaatcattaattagtgtaagatgaaacaagcaaaataatagttctgccttaccacgaatagttcgggaccttccgagtttgattcctgatgaaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
46617942 |
caaattaatcattaattagtgtaagatgacacaagcaaaataatagttctgccttaccatgaatagttcgggacattccaagtttgattcctgatgaaaa |
46618041 |
T |
 |
| Q |
215 |
tattttttggtcaaattttactta |
238 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
46618042 |
tattttttgatcaaattttactta |
46618065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 216 - 297
Target Start/End: Complemental strand, 39446265 - 39446184
Alignment:
| Q |
216 |
attttttggtcaaattttacttatctcccaaccgaattcaggattacgagagcccttctcgttgaaactagagggtaaatac |
297 |
Q |
| |
|
|||| |||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39446265 |
atttgttggccaaattttatttctctcccaaccgaattcaggattacgagagcccttctcgttgaaaccagagggtaaatac |
39446184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University