View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5890-Insertion-5 (Length: 150)
Name: NF5890-Insertion-5
Description: NF5890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5890-Insertion-5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 9 - 150
Target Start/End: Original strand, 2471508 - 2471650
Alignment:
| Q |
9 |
aaggtaacttcttctggcttgtagcatccgttcttgatatgctgtggtttgttagtttaaacttcttggttttttccatttcaaaaatggaccagaattc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2471508 |
aaggtaacttcttctggcttgtagcatccgttcttgatatgctgtggtttgttagtttcaacttcttggttttttccatttcaaaaatggaccagaattc |
2471607 |
T |
|
| Q |
109 |
gtaaatt-gggtattatagaggtcatggaaatcttctgtggat |
150 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2471608 |
gtaaattggggtattatagaggtcatggaaatcttctgtggat |
2471650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University