View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5890-Insertion-6 (Length: 122)
Name: NF5890-Insertion-6
Description: NF5890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5890-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 9 - 122
Target Start/End: Complemental strand, 17716937 - 17716825
Alignment:
| Q |
9 |
attataaattataacttaaatgttagtttaaaacaaaataatagataatacattatgaaactctaattctaaagaacataatatcaaatatgcacatgct |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17716937 |
attacaaattataacttaaatgttagtttaaaataaa-tgatagataatacattatgaaactctaattctaaagaacataatatcaaatatgcacatgct |
17716839 |
T |
|
| Q |
109 |
caaaagcactccaa |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17716838 |
caaaagcactccaa |
17716825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University