View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892-Insertion-11 (Length: 229)
Name: NF5892-Insertion-11
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892-Insertion-11 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 2706628 - 2706411
Alignment:
| Q |
9 |
aaaacatactaaagaaatgctgaaactccaatttgcagagaaaattacttcaaaaaataattttgtcatgtgaatttgatgataatagagttatgagcca |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||| | |
|
|
| T |
2706628 |
aaaacatactaaagaaatgccgaaactccagtttgcagagaaaattacttaaaaaaataattttgtcatgtgaatttgatgatagtagaattatgagcaa |
2706529 |
T |
|
| Q |
109 |
acctaacaaacaaaccattagaagagcctgcaatatatttccctaaccatctctcttccaccaacgctatagttcccatccttccctttatttctttctc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2706528 |
acctaacaaacaaaccattagaagagcctgaaaaatatttccctaaccatctctcttccaccaacgctatagttcccgtccttccctttatttctttctc |
2706429 |
T |
|
| Q |
209 |
agtatttttccctccccc |
226 |
Q |
| |
|
| ||||||| |||||||| |
|
|
| T |
2706428 |
aatattttttcctccccc |
2706411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 113 - 229
Target Start/End: Original strand, 14764221 - 14764337
Alignment:
| Q |
113 |
aacaaacaaaccattagaagagcctgcaatatatttccctaaccatctctcttccaccaacgctatagttcccatccttccctttatttctttctcagta |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| || |
|
|
| T |
14764221 |
aacaaacaaaccattagaagggcctgcaaaatatttccctaaccatctctcttccaccatcgttatagttcccatccttccctttatttctttctcaata |
14764320 |
T |
|
| Q |
213 |
tttttccctcccccctc |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14764321 |
tttttccctcccccctc |
14764337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University