View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892-Insertion-12 (Length: 134)
Name: NF5892-Insertion-12
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892-Insertion-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 5e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 9 - 134
Target Start/End: Original strand, 12507392 - 12507517
Alignment:
| Q |
9 |
ggcatatctatctatataatttgcagcaactcaaattaacatagttgcatccaagactttacatataaaatcgatttgaaaagagagttcatttttcagc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12507392 |
ggcatatctatctatataatttgcagcaactcaaattaacatagttgcatccaagactttacatataaaatcgatttgaaatgagagttcatttttcagc |
12507491 |
T |
|
| Q |
109 |
caaattttcatttatcattaatttca |
134 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
12507492 |
caaattttcatttatcattaatttca |
12507517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University