View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_25 (Length: 378)
Name: NF5892_high_25
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 31 - 353
Target Start/End: Original strand, 43327009 - 43327337
Alignment:
| Q |
31 |
tttaattgttaaaaaagcaacaaacctgtatcagagatgagtccagtccgaagcatctgaggtatggatgcaatcaaaagatatgatgcaagcatggctg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327009 |
tttaattgttaaaaaagcaacaaacctgtatcagagatgagtccagtccgaagcatctgaggtatggatgcaatcaaaagatatgatgcaagcatggctg |
43327108 |
T |
 |
| Q |
131 |
gccaaaacccagcagtagggataccaaacttgcttgccacttgtatggcccaagatgccaacaagtcaaccaccaccaaacatacatcatcaa------g |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
43327109 |
gccaaaacccagcagtagggataccaaacttgcttgccacttgtatggcccaagatgccaacaagtcaaccacaaccaaacatacatcatcaagattttg |
43327208 |
T |
 |
| Q |
225 |
attttgattttgaagaaactcttcaaaatggtttggcattatactctccatggatgattcaatggcaaagaaatctggtgttgtactgtcctcttccatc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327209 |
attttgattttgaagaaactcttcaaaatggtttggcattatactctccatggatgattcaatggcaaagaaatctggtgttgtactgtcctcttccatc |
43327308 |
T |
 |
| Q |
325 |
ccatctgccaaagcaacccacttgatgat |
353 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43327309 |
ccatctgccaaagcaacccacttgatgat |
43327337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University