View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_35 (Length: 288)
Name: NF5892_high_35
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 275
Target Start/End: Original strand, 38037385 - 38037641
Alignment:
| Q |
17 |
taatattttttgatgattgagatgggagtttgatcacgtctccaatttgttcaagttatttttcacttttatgttcatttagggcttgacttcgatgtaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38037385 |
taatattttttgatgattgagatgggagtttggtcacgtctccaatttgttcaagttatttttcacttttatgttcatttagggcttgacttcgatgtaa |
38037484 |
T |
|
| Q |
117 |
gcaagatttagatttagtttggcattcactgttttgggtgtttagaacatcaaaaaataagcttatcttctacattagtgtcagattttcaacaattaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38037485 |
gcaagatttagatttagtttggcattcactgttttgggtgtttagaacatc--aaaataagcttatcttctacattagtgtcagaatttcaacaattaat |
38037582 |
T |
|
| Q |
217 |
ggaattgattttttctcattagggccaattttgcaagagtcgcgtccctcctccttatt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38037583 |
ggaattgattttttctcattagggccaattttgcaagagtcgcgtccctcctccttatt |
38037641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University