View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_36 (Length: 288)
Name: NF5892_high_36
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 146 - 248
Target Start/End: Original strand, 13834098 - 13834200
Alignment:
| Q |
146 |
attcattgacaattttgttttgcgaaggtttttcttcaacacgtgtttctagctctttgccttcctccatagaatcacctaaattggacttccctctcct |
245 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
13834098 |
attcattgacaatattgttttgcgaaggtttttcttcaacacgtgtttctagctctttgccttccgacatagaatcacctaacttggacttcgctctcct |
13834197 |
T |
 |
| Q |
246 |
cct |
248 |
Q |
| |
|
||| |
|
|
| T |
13834198 |
cct |
13834200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 11 - 69
Target Start/End: Original strand, 13833962 - 13834020
Alignment:
| Q |
11 |
ttttatctgaggtaagatttgttactaatcttgggacttgctctgccaaaacctcaacg |
69 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13833962 |
ttttttctgaggtaagatttgttactaatcttgggacctgctctgccaaaacctcaacg |
13834020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University