View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_38 (Length: 268)
Name: NF5892_high_38
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 13833918 - 13833664
Alignment:
| Q |
1 |
aagcagaaactcccgagtttataaattgtcactaattagatgtcttaggcaatgcaatcactttatttcccagactatgggggataagtgcaaggtaata |
100 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13833918 |
aagcataaactcccgagtttctaaattgtcactgattagatgtcttaggcaatgcaatcactttatttcccagactatggatgataagtgcaaggtaata |
13833819 |
T |
 |
| Q |
101 |
acctacaattttgtcggttatcaatggtgtgcgttggtgactcgtatgttctttcgttagtcccttcctgctcctttcccttggtgtcccttggtgcctt |
200 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
13833818 |
acctacaagtttgtcagttatcaatggtgtgcgttggtggctcgtatgtcctttcgttagtcccttccttctcatttcccttggtgtcccttggtgcctt |
13833719 |
T |
 |
| Q |
201 |
ggaaggcagacttcttgactcatgccgatctcgcctctgatcttgctcataacct |
255 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13833718 |
ggaaggcagacttcttggctcatgccgatctcgtctctgatcttgctcataacct |
13833664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 80 - 125
Target Start/End: Original strand, 47900847 - 47900892
Alignment:
| Q |
80 |
ggggataagtgcaaggtaataacctacaattttgtcggttatcaat |
125 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
47900847 |
ggggataagtgcaacgtgataacctacaaatttgtcggttatcaat |
47900892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 23 - 62
Target Start/End: Original strand, 25992442 - 25992481
Alignment:
| Q |
23 |
aaattgtcactaattagatgtcttaggcaatgcaatcact |
62 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25992442 |
aaatagtcaccaattagatgtcttaggcaatgcaatcact |
25992481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 108
Target Start/End: Original strand, 1781438 - 1781527
Alignment:
| Q |
21 |
ataaattgtcactaattagatgtcttaggcaatgcaatcactttatttccca--gactatgggggataagtgcaaggtaataacctacaa |
108 |
Q |
| |
|
|||||| |||||| ||||||||| ||||| || ||||||||| ||||| | || |||||||||||||||||| ||||||||||||| |
|
|
| T |
1781438 |
ataaatggtcactgattagatgttataggccattcaatcacttaatttcttatcgattatgggggataagtgcaatataataacctacaa |
1781527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 92 - 124
Target Start/End: Complemental strand, 25136788 - 25136756
Alignment:
| Q |
92 |
aaggtaataacctacaattttgtcggttatcaa |
124 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
25136788 |
aaggtaataacctacatttttgtcggttatcaa |
25136756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 80 - 125
Target Start/End: Complemental strand, 42525246 - 42525202
Alignment:
| Q |
80 |
ggggataagtgcaaggtaataacctacaattttgtcggttatcaat |
125 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| |||||||||| |
|
|
| T |
42525246 |
ggggataagtgcaaggtaataaccaac-attttgtaggttatcaat |
42525202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 125
Target Start/End: Complemental strand, 28870976 - 28870943
Alignment:
| Q |
92 |
aaggtaataacctacaattttgtcggttatcaat |
125 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
28870976 |
aaggtaataacctacatttttgtcggttatcaat |
28870943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 125
Target Start/End: Original strand, 9354009 - 9354042
Alignment:
| Q |
92 |
aaggtaataacctacaattttgtcggttatcaat |
125 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
9354009 |
aaggtaataacctacatttttgtcggttatcaat |
9354042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University