View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_44 (Length: 256)
Name: NF5892_high_44
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 11995915 - 11995993
Alignment:
| Q |
18 |
aaacttgcatttcatttacttatatatactttattctcattaattcttacatgcattttgaagtcttctgctgattctacact |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11995915 |
aaacttgcatttcatttacttata----ctttattctcattaattcttacatgcattttgaagtcttctgctgattctacact |
11995993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 222 - 256
Target Start/End: Original strand, 11996115 - 11996149
Alignment:
| Q |
222 |
atctgtggaaattgtttatgtggttagttattttt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11996115 |
atctgtggaaattgtttatgtggttagttattttt |
11996149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University