View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_45 (Length: 255)
Name: NF5892_high_45
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 11914669 - 11914440
Alignment:
| Q |
19 |
ctcctatggtttgttggtacatgtcgaggataattgcgaagtaaaggtgctaagcatctctctaggacaagttaattccagggga--gcatgaatcagat |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11914669 |
ctcctatggtttgttggtacatatcgaggataattgcgaagtaaaggtgccaagcatctctctaggacaagttaattccaggggatcgcatgaatcagat |
11914570 |
T |
 |
| Q |
117 |
caaccacttataaaagaagggctaatgacaagaaggatattagatttcatagcaaccctatgaaatttgtcaatgaaggacaattttatactaaaagcta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11914569 |
caaccacttataaaagaagggctaatgacaagaaggatattagatttcatagcaaccctatgaaatttgtcaatgaaggacaattctatactaaaagcta |
11914470 |
T |
 |
| Q |
217 |
tgttggatatgtttcccaattcaacctatg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11914469 |
tgttggatatgtttcccaattcaacctatg |
11914440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University