View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5892_high_48 (Length: 254)

Name: NF5892_high_48
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5892_high_48
NF5892_high_48
[»] chr3 (1 HSPs)
chr3 (20-176)||(38997120-38997274)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 176
Target Start/End: Original strand, 38997120 - 38997274
Alignment:
20 tatctttagtttttgcctctgtttatgcctttagttgtgaagttatgtttcggttcaatctggtttagtgatacaatcttttttgtagacgccaagatat 119  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||||    
38997120 tatctttagtttttgcctctgcttatgcctttagttgtgaagttatgtttcggttcaatttggtt--gtgatacaatcttttttgtagacgccaagatat 38997217  T
120 acgactgagttacttagattcagtcatacggatcaaccggtgatccaacaatctctt 176  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38997218 acgactgagttacttagattcagtcatacggatcaaccggtgatccaacaatctctt 38997274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University