View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_48 (Length: 254)
Name: NF5892_high_48
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 176
Target Start/End: Original strand, 38997120 - 38997274
Alignment:
| Q |
20 |
tatctttagtttttgcctctgtttatgcctttagttgtgaagttatgtttcggttcaatctggtttagtgatacaatcttttttgtagacgccaagatat |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38997120 |
tatctttagtttttgcctctgcttatgcctttagttgtgaagttatgtttcggttcaatttggtt--gtgatacaatcttttttgtagacgccaagatat |
38997217 |
T |
 |
| Q |
120 |
acgactgagttacttagattcagtcatacggatcaaccggtgatccaacaatctctt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997218 |
acgactgagttacttagattcagtcatacggatcaaccggtgatccaacaatctctt |
38997274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University