View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_49 (Length: 254)
Name: NF5892_high_49
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 2706628 - 2706403
Alignment:
| Q |
18 |
aaaacatactaaagaaatgctgaaactccaatttgcagagaaaattacttcaaaaaataattttgtcatgtgaatttgatgataatagagttatgagcca |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||| | |
|
|
| T |
2706628 |
aaaacatactaaagaaatgccgaaactccagtttgcagagaaaattacttaaaaaaataattttgtcatgtgaatttgatgatagtagaattatgagcaa |
2706529 |
T |
 |
| Q |
118 |
acctaacaaacaaaccattagaagagcctgcaatatatttccctaaccatctctcttccaccaacgctatagttcccatccttccctttatttctttctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2706528 |
acctaacaaacaaaccattagaagagcctgaaaaatatttccctaaccatctctcttccaccaacgctatagttcccgtccttccctttatttctttctc |
2706429 |
T |
 |
| Q |
218 |
agtatttttccctcccccctcttcttc |
244 |
Q |
| |
|
| ||||||| ||| ||||||||||||| |
|
|
| T |
2706428 |
aatattttttcct-ccccctcttcttc |
2706403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 122 - 244
Target Start/End: Original strand, 14764221 - 14764343
Alignment:
| Q |
122 |
aacaaacaaaccattagaagagcctgcaatatatttccctaaccatctctcttccaccaacgctatagttcccatccttccctttatttctttctcagta |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| || |
|
|
| T |
14764221 |
aacaaacaaaccattagaagggcctgcaaaatatttccctaaccatctctcttccaccatcgttatagttcccatccttccctttatttctttctcaata |
14764320 |
T |
 |
| Q |
222 |
tttttccctcccccctcttcttc |
244 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14764321 |
tttttccctcccccctcttcttc |
14764343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University