View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_57 (Length: 244)
Name: NF5892_high_57
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_57 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 131 - 244
Target Start/End: Complemental strand, 33994380 - 33994267
Alignment:
| Q |
131 |
gatattgacaactctattttgnnnnnnngaggggacctagtgataactctattgttgctcatatgcttatacaactaagtccaacatgtataatactaca |
230 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33994380 |
gatagtgacaactctattttgtttttttgaggggacctagtgataactctattgttgctcatatgcttatactactaagtccaacatatataatactact |
33994281 |
T |
|
| Q |
231 |
gctttactttccca |
244 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33994280 |
gctttactttccca |
33994267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 23 - 132
Target Start/End: Complemental strand, 33994521 - 33994413
Alignment:
| Q |
23 |
agtgactacatcattcgattacnnnnnnntgattagaaactaaaatagaaaaggcttgacatttcaaatatagctttgcatgcaaaaataaagtaccggt |
122 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| || |
|
|
| T |
33994521 |
agtgactacatcattcgattacaaaaaaatgattagaaactaaaatagaaaaggcttgacattccaaatatagctttgcatgc-taaataaagtaccagt |
33994423 |
T |
|
| Q |
123 |
cactatggga |
132 |
Q |
| |
|
|||||||||| |
|
|
| T |
33994422 |
cactatggga |
33994413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University