View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_59 (Length: 243)
Name: NF5892_high_59
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_59 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 21376890 - 21376665
Alignment:
| Q |
18 |
ctttttggagtatgaataccattcttttggttgttccatagaactggatcttcctcggtatcattgaaattcatgtgagtgaggtttatgtgatcataaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21376890 |
ctttttggagtatgaataccattcttttggttgttccatagaactggatcttcctcggtatcattgaaattcatgtgagtgaggtttatgtgatcataaa |
21376791 |
T |
 |
| Q |
118 |
ttgtattagatggcagaatattcgtgtggggatcattagaagtgagcacatcttttacggttagatgcaagtcatgtatgtcaatataagggacaagaga |
217 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21376790 |
ttgtattagatagcagaatattcgtgtggggatcattagaagtgagcacatcttttacggttagatgcaagtcatgtatgtcaatataagggacaagaga |
21376691 |
T |
 |
| Q |
218 |
cccaagaacaccaaaaaagctccttc |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21376690 |
cccaagaacaccaaaaaagctccttc |
21376665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 132 - 221
Target Start/End: Complemental strand, 9535824 - 9535735
Alignment:
| Q |
132 |
agaatattcgtgtggggatcattagaagtgagcacatcttttacggttagatgcaagtcatgtatgtcaatataagggacaagagaccca |
221 |
Q |
| |
|
|||||||| || || |||||||| | || ||| |||||||| || || || ||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
9535824 |
agaatatttgtctgcggatcatttgcagagagaacatctttaacagtgagctgcaagtcatggatatcaatataagggacaagagaccca |
9535735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University