View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_high_66 (Length: 239)
Name: NF5892_high_66
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_high_66 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 54890622 - 54890386
Alignment:
| Q |
1 |
ttctcctctcatgcagtggtgtaaacttataattggaactatctttgatacagtaaacccnnnnnnnnaatcggggcaaatgttacttgttagtaattta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54890622 |
ttctcctctcatgcagtggtgtaaacttataattggaactatctttgatacag-aaacccttttttt-aatcggggcaaatgttacttgttagtaattta |
54890525 |
T |
 |
| Q |
101 |
gtgatgattatattagtttttagagtttgaaccacgacgtattggttataacttataagctttgtagtcggtgtctagcgtgtgctagtatccaacaccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54890524 |
gtgatgattatattagtttttagagtttgaaccacgacatattggttataacttataagctttgtagtcggtgtctagcgtgtgctagtatccaacaccg |
54890425 |
T |
 |
| Q |
201 |
acacatcttacattcaatcacttttgttttctcaatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54890424 |
acacatcttacattcaatcacttttgttttctcaatatt |
54890386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 195 - 235
Target Start/End: Complemental strand, 38806946 - 38806906
Alignment:
| Q |
195 |
acaccgacacatcttacattcaatcacttttgttttctcaa |
235 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
38806946 |
acaccgacacatgttacattcaatcacttttgttttttcaa |
38806906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University