View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5892_high_72 (Length: 234)

Name: NF5892_high_72
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5892_high_72
NF5892_high_72
[»] chr6 (2 HSPs)
chr6 (35-102)||(29620708-29620775)
chr6 (136-185)||(29620781-29620830)


Alignment Details
Target: chr6 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 35 - 102
Target Start/End: Original strand, 29620708 - 29620775
Alignment:
35 aaaaatggatcttgttaacgagtgttgctgagacaatccttaacatttccttaaaaagattgtaacaa 102  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
29620708 aaaaatggatcttgttaacgagtgttcctgagacaatccttaacatttccttaaaaagattgtaacaa 29620775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 136 - 185
Target Start/End: Original strand, 29620781 - 29620830
Alignment:
136 agcttcaaaaactctttgagcttcccaaatcaaaagagttttgtattatg 185  Q
    |||||||||||||||||||||||||||||| | |||||||||||||||||    
29620781 agcttcaaaaactctttgagcttcccaaatgagaagagttttgtattatg 29620830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University