View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_low_51 (Length: 251)
Name: NF5892_low_51
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 41 - 233
Target Start/End: Complemental strand, 15584240 - 15584042
Alignment:
| Q |
41 |
tataaatggttgctctcattcggtttgtttcttactt-actcactaaggaaatgtgctttagtttaacgcagcagtgtgtataag-----tgtttgtgtg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
15584240 |
tataaatggttgctctcattcggtttgtttcttactttactcactaaggaaatgtgctttagtttaacgcagcagtgtgtataaggaaagtgcttgtgtg |
15584141 |
T |
|
| Q |
135 |
taagtgccgtatgtattggtttgcttacgtgttgcttaatttcgaagccacgtattctacacgttatgtccacttctcaaagcatggagattcccattt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15584140 |
taagtgccgtatgtattggtttgcttacgtgttgcttaatttcgaagccacgtattctacacgttatgtccacttctcaaagcatggagattcccattt |
15584042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 922047 - 921999
Alignment:
| Q |
185 |
cgtattctacacgttatgtccacttctcaaagcatggagattcccattt |
233 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
922047 |
cgtattctatacgttatgtctacttctcaaagcatggagattcccattt |
921999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University