View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_low_54 (Length: 247)
Name: NF5892_low_54
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 11996214 - 11996407
Alignment:
| Q |
1 |
aaaaaagcttatgttataaaaatgcttttgttactgccaatggtttgaaaaaaga-gcttttcattacaaaagtatgttgaatgaactgatgatagtgat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11996214 |
aaaaaagcttatgttataaaaatgcttttgttactaccaatggtttgaaaaaaaaagcttttcattacaaaagtatgttgaatgaactgatgatagtgat |
11996313 |
T |
 |
| Q |
100 |
gttagaataatcatttaattaacatcttaagatgatttactcacttatatgaaatcaccaaaaagttgagattttgaaatttatggtaaaaatt |
193 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11996314 |
gttggaataatcatttaattaacatcttaagatgatttacttacttatatgaaatcaccaaaaagttgagattttgaaatttatggtaagaatt |
11996407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 186 - 242
Target Start/End: Original strand, 11996429 - 11996485
Alignment:
| Q |
186 |
taaaaattgtacactgtaatttctttttctactcatagggtaccttgcacctttgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11996429 |
taaaaattgtacactgtaatttctttttctactcatagggtaccttgtacctttgct |
11996485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University