View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_low_69 (Length: 238)
Name: NF5892_low_69
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_low_69 |
 |  |
|
| [»] chr1 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 1637211 - 1637448
Alignment:
| Q |
1 |
aactccagggaagatgataggtttggcaacttggagaatggaaatgttgtaaggctgtttgacaacggttttcacaagcgcaacgtcgattggagcacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1637211 |
aactccagggaagatgataggtttggcaacttggagaatggaaatgttgtaaggctgtttgacaacggttttcacaagggcaacgtcgattggagcacca |
1637310 |
T |
 |
| Q |
101 |
ctcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcctgaggcttggaaaagggtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1637311 |
ctcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcctgaggcttggaaaagggtgg |
1637410 |
T |
 |
| Q |
201 |
tcaagagtatgccactgcccacagcttcactgagcttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1637411 |
tcaagagtatgccactgcccacagcttcactgagcttc |
1637448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 4 - 205
Target Start/End: Original strand, 1612609 - 1612810
Alignment:
| Q |
4 |
tccagggaagatgataggtttggcaacttggagaatggaaatgttgtaaggctgtttgacaacggttttcacaagcgcaacgtcgattggagcaccactc |
103 |
Q |
| |
|
||||||||| | ||||||||| || ||||||| |||| |||||||| ||||| || ||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
1612609 |
tccagggaacaagataggtttcgcgacttggattatggtgatgttgtagggctgggcgaaaacaactttcactagcttaacgtcgattggagcaccactc |
1612708 |
T |
 |
| Q |
104 |
acagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcctgaggcttggaaaagggtggtca |
203 |
Q |
| |
|
||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||||||| |||| |||||||||||| |
|
|
| T |
1612709 |
acagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcctgaggattggtaaagggtggtca |
1612808 |
T |
 |
| Q |
204 |
ag |
205 |
Q |
| |
|
|| |
|
|
| T |
1612809 |
ag |
1612810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 82 - 208
Target Start/End: Original strand, 1629223 - 1629349
Alignment:
| Q |
82 |
aacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcct |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||| |
|
|
| T |
1629223 |
aacgtcgattggagcaccactcacagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcct |
1629322 |
T |
 |
| Q |
182 |
gaggcttggaaaagggtggtcaagagt |
208 |
Q |
| |
|
|||| |||| |||||||| |||||||| |
|
|
| T |
1629323 |
gaggattggtaaagggtgatcaagagt |
1629349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 82 - 208
Target Start/End: Original strand, 1622155 - 1622281
Alignment:
| Q |
82 |
aacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcct |
181 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||| |
|
|
| T |
1622155 |
aacgtcgatgggagcaccactcacagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcct |
1622254 |
T |
 |
| Q |
182 |
gaggcttggaaaagggtggtcaagagt |
208 |
Q |
| |
|
|||| |||| |||||||| |||||||| |
|
|
| T |
1622255 |
gaggattggtaaagggtgatcaagagt |
1622281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University