View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5892_low_73 (Length: 227)
Name: NF5892_low_73
Description: NF5892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5892_low_73 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 12507722 - 12507508
Alignment:
| Q |
11 |
atcatcatggtgcttcttggcttattttgattgatgcctgctaaaaatttgttatgagcatcttttcaaaaagttaatcaagagcataaactcttatgtt |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12507722 |
atcataatggtgcttcttggcttattttgattgatgcctgctaaaaatttgttatgggcatcttttcaaaaagttaatcaagagcataaactcttatgtt |
12507623 |
T |
 |
| Q |
111 |
atatgatgaagagttgaagactatgttcttatagcatgtatgtacatacagaacaaaactttagttttatatgagaaaagtgtttagtttaattatgtcg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
12507622 |
atatgatgaagagttgaagactatgttcttatagcatgtatgtacatacagaacaaaactttagttttatatgagaaaa--gtttagtttaattatgcca |
12507525 |
T |
 |
| Q |
211 |
aagaatatgaaattaat |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
12507524 |
aagaatatgaaattaat |
12507508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University