View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5893-Insertion-4 (Length: 295)
Name: NF5893-Insertion-4
Description: NF5893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5893-Insertion-4 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 8 - 295
Target Start/End: Original strand, 43356721 - 43357008
Alignment:
| Q |
8 |
acaggtaaaataaatattatcaaccattggttaacacatttaagtagatattagaagtagatcataacaaatcacaagtttgttgaaatagcaatacgtg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43356721 |
acaggtaaaataaatattatcaaccattggttaacacatttaagtagatattagaagtagatcataacaaatcacaagtttgttgaaataacaatacgtg |
43356820 |
T |
 |
| Q |
108 |
attgtctcacttatactcaaattagaagagctaaattcgtaaagttctatggatattttaagtattaatatttattggatactggttcactctctttaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43356821 |
attgtctcacttatactcaaattagaagagctaaattcgtaaagttctatggatattttaagtattaatatttattggatactggttcactctctttaag |
43356920 |
T |
 |
| Q |
208 |
agcttgagaattctcactacttcagtcaacacaaccgctggttccttggtatcaactccaaccattgcagctaacagttcaattttgt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43356921 |
agcttgagaattctcactacttcagtcaacacaaccgctggttccttggtatcaactccaaccattgaagctaacagttcaattttgt |
43357008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 97
Target Start/End: Complemental strand, 39421626 - 39421553
Alignment:
| Q |
25 |
tatcaaccattggttaacacatttaag-tagatattagaagtagatcataacaaatcacaagtttgttgaaata |
97 |
Q |
| |
|
|||||||||||| |||||| || ||| ||||||||||||||| | |||||||||||| |||||||| ||||| |
|
|
| T |
39421626 |
tatcaaccattgattaacaaatcaaaggtagatattagaagtacaccataacaaatcatgagtttgttaaaata |
39421553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 214 - 293
Target Start/End: Original strand, 33492627 - 33492706
Alignment:
| Q |
214 |
agaattctcactacttcagtcaacacaaccgctggttccttggtatcaactccaaccattgcagctaacagttcaatttt |
293 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| | || |||||||||||||||||||| || ||||||||||| |
|
|
| T |
33492627 |
agaattcttactacttcagtcaacacaattgctggttcagtagtgtcaactccaaccattgcagccaaaagttcaatttt |
33492706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University