View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5893-Insertion-7 (Length: 226)
Name: NF5893-Insertion-7
Description: NF5893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5893-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 9955581 - 9955364
Alignment:
| Q |
9 |
ctcggcacatgagcgaagacgagagcagaagcgggaagttcaaacatctcggttacatggtttaagaccacggttatcagagaaaggagttaggagaaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
9955581 |
ctcggcacatgagcgaagacgagagcagaagcgggaagttcaaacatctcggttacattgtttaagaccaaggttctcagagaaaggagttaggggaaca |
9955482 |
T |
|
| Q |
109 |
tatacgtggcgaggtaacctcgagatggttcttggccaggatagattttgagccttcataaagaggggacttggcctaagaaacaacgatcactttcaca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||| |
|
|
| T |
9955481 |
tatacgtggcgaggtaacctcgagatggttcttggccaggatagattttgagccttcataaagaggggacttggcctgagaaacggcgatcacttttaca |
9955382 |
T |
|
| Q |
209 |
aaacagaaataccaccac |
226 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9955381 |
aaacagaaataccaccac |
9955364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University