View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5893-Insertion-9 (Length: 115)
Name: NF5893-Insertion-9
Description: NF5893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5893-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 9 - 115
Target Start/End: Complemental strand, 3646743 - 3646639
Alignment:
| Q |
9 |
tcattttcatctaaatatgctttatccaccaggatcgccgcaacttgctataaatttattattatctatatatttttgtgcgatattgttaaggtttatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
3646743 |
tcattttcatctaaatatgctttatccaccaggatcgccgcaacttgctataaatttattattatctttata--tttgttcgatattgttaaggtttatc |
3646646 |
T |
 |
| Q |
109 |
gtctgcc |
115 |
Q |
| |
|
||||||| |
|
|
| T |
3646645 |
gtctgcc |
3646639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University