View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5893_high_1 (Length: 483)
Name: NF5893_high_1
Description: NF5893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5893_high_1 |
 |  |
|
| [»] scaffold0722 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 317 - 473
Target Start/End: Original strand, 5015999 - 5016155
Alignment:
| Q |
317 |
ttttttgtggcagtgtcctttcttttggattaagctgatatcaataaatgactttcacgtgttttatatttagtattgtcactctcttcatgttgaacaa |
416 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5015999 |
ttttttgtagcagtgtcctttcttttggattaagctgatatcaataaatgactttcacgggttttatatttagtattgtcactctcttcatgtggaacaa |
5016098 |
T |
 |
| Q |
417 |
tttccttacctaaaatctagcaatgtttataattacatttggaaatttacacaagta |
473 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
5016099 |
tttccttacctaaaatctagcaatggttataattacatttggaaatttatacaagta |
5016155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0722 (Bit Score: 136; Significance: 9e-71; HSPs: 2)
Name: scaffold0722
Description:
Target: scaffold0722; HSP #1
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 2208 - 2037
Alignment:
| Q |
16 |
gttgatacttttgtt-gacttgtctaagcttaaacatcctaatcttttgccactttctggatactgcatcgcaggtaatcattttctatgcgttt-ttta |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2208 |
gttgatacttttgtttgacttgtctaagcttaaacatcccaatcttttgccactttctggttactgcatcgcaggtaatcattttctatgcgtttattta |
2109 |
T |
 |
| Q |
114 |
atctatgtagcatcgacatttttgataaaagatatatctaatatccgagacatatttgatatcaacacgaca |
185 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2108 |
atctatgtaacatcgacacttttgataaaagatatatctaatatcagagacatatttgatatcaacacgaca |
2037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0722; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 194 - 229
Target Start/End: Complemental strand, 2004 - 1969
Alignment:
| Q |
194 |
ttgatttcaaattattatcggtgttaaatgtattag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2004 |
ttgatttcaaattattatcggtgttaaatgtattag |
1969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University