View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5894_low_2 (Length: 240)
Name: NF5894_low_2
Description: NF5894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5894_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 40 - 225
Target Start/End: Complemental strand, 408801 - 408616
Alignment:
| Q |
40 |
tttgaaactatccctaaagtttcaactcttcaaaaagttacaaagagtttgggaaaatttacgtctattacataaaaagttataaagtatcattaagaag |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408801 |
tttgaaactatccctaaagtttcaactcttcaaaaagttacaaagagtttgagaaaatttacgtctattacataaaaagttataaagtatcattaagaag |
408702 |
T |
 |
| Q |
140 |
ttacaagatgaaggcaagtgtgacactggttttcatccaaatttcccaaaatttgctggccctcttaatctgatcacacatctgtg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408701 |
ttacaagatgaaggcaagtgtgacactggttttcatccaaatttcccaaaatttgctggccctcttaatctgatcacacatctgtg |
408616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University