View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5896_low_14 (Length: 244)
Name: NF5896_low_14
Description: NF5896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5896_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 45459044 - 45458838
Alignment:
| Q |
19 |
gggttgtgatccaatactctagcaagtagacagggtgtgatttattcaaccaaatattaaggaggtttacttggacgcaatttgagaaaaaggtggagct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459044 |
gggttgtgatccaatactctagcaagtagacaaggtgtgacttattcaaccaaatattaaggaggtttacttggacgcaatttgagaaaaaggtggagct |
45458945 |
T |
 |
| Q |
119 |
ttcttcatattgctgggccagttttgagtttgacaatttatttatacgcgtatgcctatacttagctgttctctaaaattagttaattatcagtgctact |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45458944 |
ttcttcatattgctaggccagttttgagtttgacaatttatttatacgcgtatgcctatacttagctgttctctaaaattagttaattatcagtgctact |
45458845 |
T |
 |
| Q |
219 |
aattgag |
225 |
Q |
| |
|
||||||| |
|
|
| T |
45458844 |
aattgag |
45458838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University