View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5896_low_19 (Length: 223)
Name: NF5896_low_19
Description: NF5896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5896_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 9 - 178
Target Start/End: Original strand, 53700048 - 53700205
Alignment:
| Q |
9 |
aagaatatcatcaactccaaaaacaagaatatattttaacatcagaacattcatatcatatcaactagctagtacattttattcataatatatagaagta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53700048 |
aagaatatcatcaactccaaaaacaagaatatattttaacatcagaacat-----tcatatcaactagctagtacattttattcata----atagaagta |
53700138 |
T |
|
| Q |
109 |
agta-ttttaactagagaaaaaagagttacagtaaatattttatgcctgatcgacttaaatcaattggata |
178 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
53700139 |
agtatttttaactagagaaaaaagagttacagtaaatattttatgc----ttgacttaaatcaattggata |
53700205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University