View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5896_low_20 (Length: 215)
Name: NF5896_low_20
Description: NF5896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5896_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 10 - 197
Target Start/End: Original strand, 37338722 - 37338909
Alignment:
| Q |
10 |
gtagataatactcatgatagaaagtctataaaatgtaatgttacaatggatgaaagtatttacaatgatgcatatagcatgacagaaagcagggatgtca |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37338722 |
gtagttaatactcatgatagaaagtctataaaatgtaatgttacaatggatgaaagtatttacaatgatgcatatagcatgacagaaagcagggatgtca |
37338821 |
T |
 |
| Q |
110 |
tttcatttacatttaaatctccattgaggaaaaatgcatctcagtcgcagtcgactactaagcaagtgatggaaacaaggaccagaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37338822 |
tttcatttacatttaaatctccattgaggaaaaatgcatctcagtcgcagtcgactactaagcaagtgatggaaacaaggaccagaat |
37338909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University