View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5897_low_24 (Length: 263)
Name: NF5897_low_24
Description: NF5897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5897_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 71 - 246
Target Start/End: Complemental strand, 4389876 - 4389698
Alignment:
| Q |
71 |
cttggtggaatttcagtactccgcattgggctaccctcccacc---ctcttctttctactgctcctgcgcaatttcaccgtgccttgcaagacatcctca |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389876 |
cttggtggaatttcagtactccgcattgggctaccctcccaccaccctcttctttctactgctcctgcgcaatttcaccgtgccttgcaagacatcctca |
4389777 |
T |
|
| Q |
168 |
tcatcatgaagcgaaaacacaccaaagcttttaccaatgtcctcatgtgcatctattttgttttgtaaatccctatgaa |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389776 |
tcatcatgaagcgaaaacacaccaaagcttttaccaatgtcctcatgtgcatctattttgttttgtaaatccctatgaa |
4389698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 4389955 - 4389897
Alignment:
| Q |
18 |
gatatcaaacatcaagcactcctggaaacaacacaccattccactcacctcttcttggt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389955 |
gatatcaaacatcaagcactcctggaaacaacacaccattccactcacctcttcttggt |
4389897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University