View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5897_low_31 (Length: 248)
Name: NF5897_low_31
Description: NF5897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5897_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 35286594 - 35286378
Alignment:
| Q |
1 |
tagtaaaaataaaggaatattataaataaaggtatccgaacgcgatctagactgcaacatcgatgttttttatgtttacatgaccgcaatatgaatgcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35286594 |
tagtaaaaataaaggaatattataaataaaggtctccgaacgcgatctagactgcaacatcgatgttttttatgtttacatgaccgcaatatgaatg--- |
35286498 |
T |
 |
| Q |
101 |
tcacgtaagttgtattggatcatgattctctacaatatcatatattgtgacgcgacggtgaccatgatttaaaacatcgcatatatacatacatataacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35286497 |
------------tattggatcatgattctctacaatatcatatattgtgacgcgacggtgaccatgatttaaaacatcgcatatatacatacatataacg |
35286410 |
T |
 |
| Q |
201 |
aggcgaggcacattattaattacctggtgttt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35286409 |
aggcgaggcacattattaattacctggtgttt |
35286378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University