View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5897_low_37 (Length: 224)
Name: NF5897_low_37
Description: NF5897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5897_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 34497446 - 34497639
Alignment:
| Q |
17 |
caagcttcagcaatggctccattggcagccatgtaaccaaattttaagtagggacagatttcaaaaagcagttgcatgtaagtgagtaattcttcacctt |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34497446 |
caagcttcggcaatggctccattggcagccatgtaaccaaattttaagtagggacagatttcgaaaagcagttgcatgtaagtgagtaattcttcacctt |
34497545 |
T |
 |
| Q |
117 |
caggctctctgcacttaagggcatgatagatactattccctgacgcttctgtccttgcaacaagaccttctaccatataagcaccgagtctctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34497546 |
caggctctctgcacttaagggcatgatagatactattccctgacgcttctgtccttgcaacaagaccttctaccatataagcaccgagcctctg |
34497639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 42701735 - 42701689
Alignment:
| Q |
20 |
gcttcagcaatggctccattggcagccatgtaaccaaattttaagta |
66 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
42701735 |
gcttctgcaatggctccatttgcagacatgtaaccaaatttgaagta |
42701689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University