View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5897_low_38 (Length: 220)
Name: NF5897_low_38
Description: NF5897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5897_low_38 |
 |  |
|
| [»] scaffold0338 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 160 - 210
Target Start/End: Original strand, 16116913 - 16116963
Alignment:
| Q |
160 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttctttccgcct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16116913 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttgtttccgcct |
16116963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 180747 - 180783
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
180747 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
180783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 23174554 - 23174510
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
23174554 |
gtggtgatgatgatgaacgatggtgatgattcagtttgtttccgc |
23174510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Complemental strand, 23921089 - 23921053
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23921089 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
23921053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 200
Target Start/End: Complemental strand, 8401558 - 8401523
Alignment:
| Q |
165 |
tggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8401558 |
tggtgatgatgatgaacgacggtgatgattcagttt |
8401523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 34370430 - 34370466
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34370430 |
gtggtgatgatgatgaacgacggtcatgattcagttt |
34370466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0338 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0338
Description:
Target: scaffold0338; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 6416 - 6460
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6416 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
6460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 44140242 - 44140194
Alignment:
| Q |
160 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44140242 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttgtttccgc |
44140194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 15974011 - 15973968
Alignment:
| Q |
165 |
tggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15974011 |
tggtgatgatgatgaacgacggtgatgattcagtttgtttccgc |
15973968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 48306245 - 48306289
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
48306245 |
gtggtgatgatgatgaacgacggtgatgattcagcttgtttccgc |
48306289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 48691942 - 48691986
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
48691942 |
gtggtgatgatgatgaacgaaggtgatgattcagtttgtttccgc |
48691986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 46572726 - 46572683
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccg |
207 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
46572726 |
gtggtgatgatgatgaaggacggtgatgattcagtttgtttccg |
46572683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 12286058 - 12286086
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12286058 |
aaaccatttccaactaacatatacaattt |
12286086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 39007110 - 39007082
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39007110 |
aaaccatttccaactaacatatacaattt |
39007082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 44140392 - 44140364
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44140392 |
aaaccatttccaactaacatatacaattt |
44140364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 16667846 - 16667798
Alignment:
| Q |
160 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16667846 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttgtttccgc |
16667798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 34330083 - 34330127
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34330083 |
gtggtgatgatgatgaacgacggtgatgattcagtttgtttccgc |
34330127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 16667980 - 16667952
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16667980 |
aaaccatttccaactaacatatacaattt |
16667952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 1672626 - 1672674
Alignment:
| Q |
160 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1672626 |
tccggtgttgatgatgatgaacgacggtgatgattcagtttgtttccgc |
1672674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 2751137 - 2751181
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2751137 |
gtggtgatgatgatgaacgacggtgatgattcagtttgtttccgc |
2751181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 164 - 207
Target Start/End: Original strand, 8551227 - 8551270
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8551227 |
gtggtgatgatgatgaacgacggtgatgattcagtttgtttccg |
8551270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Complemental strand, 4835669 - 4835633
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4835669 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
4835633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Complemental strand, 4841114 - 4841078
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4841114 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
4841078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 39657850 - 39657806
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
39657850 |
gtggtgatgatgatgaacgacgttgatgattcagtttgtttccgc |
39657806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 1672476 - 1672504
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1672476 |
aaaccatttccaactaacatatacaattt |
1672504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 19384533 - 19384489
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19384533 |
gtggtgatgatgatgaacgacggtgatgattcagtttgtttccgc |
19384489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 51361665 - 51361621
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51361665 |
gtggtgttgatgatgaacgacggtgatgattcagtttgtttccgc |
51361621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Complemental strand, 52986633 - 52986597
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52986633 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
52986597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 168 - 210
Target Start/End: Complemental strand, 7044504 - 7044462
Alignment:
| Q |
168 |
tgatgatgatgaacgacggtgatgattcagtttctttccgcct |
210 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
7044504 |
tgatgatgataaacgacggtgatgattcagtttgtttccgcct |
7044462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 31853083 - 31853127
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
31853083 |
gtggtgatgatgatgaacgacggtgataatttagtttgtttccgc |
31853127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 206
Target Start/End: Original strand, 50755084 - 50755126
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttcc |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
50755084 |
gtggtgataatgatgaacgacggtgatgatccagtttgtttcc |
50755126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 1366051 - 1366023
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1366051 |
aaaccatttccaactaacatatacaattt |
1366023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 9642701 - 9642673
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9642701 |
aaaccatttccaactaacatatacaattt |
9642673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 17621385 - 17621357
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17621385 |
aaaccatttccaactaacatatacaattt |
17621357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 17628568 - 17628540
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17628568 |
aaaccatttccaactaacatatacaattt |
17628540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 28299402 - 28299374
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28299402 |
aaaccatttccaactaacatatacaattt |
28299374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 4280871 - 4280823
Alignment:
| Q |
160 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
4280871 |
tccggtggtgatgatgatgaacgatggtgatgattcagtttgtttccgc |
4280823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 200
Target Start/End: Complemental strand, 4962655 - 4962615
Alignment:
| Q |
160 |
tccggtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4962655 |
tccggtggtgatgatgatgaacgacggtgatgattcagttt |
4962615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 25995944 - 25995992
Alignment:
| Q |
160 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
25995944 |
tccggtggtgatgatgatgaccgacggtgatgattcagtttgtttccgc |
25995992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 14550582 - 14550539
Alignment:
| Q |
165 |
tggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14550582 |
tggtgatgatgatgaacgacggtgatgattcagtttgtttccgc |
14550539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 205
Target Start/End: Complemental strand, 4578711 - 4578670
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4578711 |
gtggtgatgatgatgaacgacggtgatgattcagtttgtttc |
4578670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 205
Target Start/End: Original strand, 25193883 - 25193924
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25193883 |
gtggtgatgatgatgaacgacggtgatgattcagtttgtttc |
25193924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 36635930 - 36635885
Alignment:
| Q |
163 |
ggtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
36635930 |
ggtggtgatgatgatgaccgacggtgatgattcagtttgtttccgc |
36635885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 2264546 - 2264590
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
2264546 |
gtggtgatgatgatgaacaacgatgatgattcagtttgtttccgc |
2264590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 18297315 - 18297271
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
18297315 |
gtggtgatgatgatgaacgacaatgatgattcagtttgtttccgc |
18297271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 41
Target Start/End: Original strand, 43823588 - 43823617
Alignment:
| Q |
12 |
caaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43823588 |
caaaccatttccaactaacatatacaattt |
43823617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 43823739 - 43823787
Alignment:
| Q |
160 |
tccggtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
43823739 |
tccgatggtgatgatgatgaacgacaatgatgattcaatttgtttccgc |
43823787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 18612220 - 18612266
Alignment:
| Q |
162 |
cggtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
18612220 |
cggtggtgatgatgatgaacgacggtgatgatttagtttgtttccgc |
18612266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 878293 - 878329
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
878293 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
878329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 33345478 - 33345438
Alignment:
| Q |
168 |
tgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33345478 |
tgatgatgatgaacgacggtgatgattcagtttgtttccgc |
33345438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 29163591 - 29163634
Alignment:
| Q |
165 |
tggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
29163591 |
tggtgatgatgatgaacgacagtgatgattcagtttgtttccgc |
29163634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 208
Target Start/End: Complemental strand, 24736706 - 24736669
Alignment:
| Q |
171 |
tgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24736706 |
tgatgatgaacgacggtgatgattcagtttgtttccgc |
24736669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 18612068 - 18612096
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18612068 |
aaaccatttccaactaacatatacaattt |
18612096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 18756296 - 18756268
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18756296 |
aaaccatttccaactaacatatacaattt |
18756268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 15)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 164 - 206
Target Start/End: Complemental strand, 26577408 - 26577366
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttcc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26577408 |
gtggtgatgatgatgaacgacggtgatgattcagtttgtttcc |
26577366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 10473540 - 10473584
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
10473540 |
gtggtgatgatgatgaacgacggtgatgattcaatttgtttccgc |
10473584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 48077092 - 48077052
Alignment:
| Q |
168 |
tgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48077092 |
tgatgatgatgaacgacggtgatgattcagtttgtttccgc |
48077052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 38245815 - 38245851
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38245815 |
gtggtgatgatgatgaacgacggtgataattcagttt |
38245851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 45256792 - 45256836
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
45256792 |
gtggtggtgatgatgaacaacggtgatgattcagtttgtttccgc |
45256836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 208
Target Start/End: Complemental strand, 51836468 - 51836431
Alignment:
| Q |
171 |
tgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
51836468 |
tgatgatgaacgacggtaatgattcagtttgtttccgc |
51836431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 6385666 - 6385638
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6385666 |
aaaccatttccaactaacatatacaattt |
6385638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 191
Target Start/End: Complemental strand, 9551770 - 9551742
Alignment:
| Q |
163 |
ggtggtgatgatgatgaacgacggtgatg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9551770 |
ggtggtgatgatgatgaacgacggtgatg |
9551742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 14504203 - 14504175
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14504203 |
aaaccatttccaactaacatatacaattt |
14504175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 24687194 - 24687222
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24687194 |
aaaccatttccaactaacatatacaattt |
24687222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 25573531 - 25573503
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25573531 |
aaaccatttccaactaacatatacaattt |
25573503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 48077246 - 48077218
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48077246 |
aaaccatttccaactaacatatacaattt |
48077218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 196
Target Start/End: Original strand, 50644596 - 50644628
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattca |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
50644596 |
gtggtgatgatgatgaacgactgtgatgattca |
50644628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 55781914 - 55781942
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55781914 |
aaaccatttccaactaacatatacaattt |
55781942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 55846094 - 55846122
Alignment:
| Q |
13 |
aaaccatttccaactaacatatacaattt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55846094 |
aaaccatttccaactaacatatacaattt |
55846122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 24469 - 24425
Alignment:
| Q |
164 |
gtggtgatgatgatgaacgacggtgatgattcagtttctttccgc |
208 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
24469 |
gtggtgatgatgatgaacgaagatgatgattcagtttgtttccgc |
24425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University